Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

C.B. Spillane, J.L. Morgan, Nicholas Fletcher, J.G. Collins, F.R. Keene

Research output: Contribution to journalArticle

13 Citations (Scopus)

Abstract

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Original languageEnglish
Pages (from-to)3122-3133
Number of pages12
JournalDalton Transactions
Volume2006
Issue number25
DOIs
Publication statusPublished - Feb 2006

Fingerprint

Ruthenium
Enantiomers
Oligonucleotides
DNA
2,2'-Dipyridyl
Association reactions
Intercalating Agents
Molecular modeling
Coordination Complexes
benzothiazole
Assays
Nuclear magnetic resonance
bis(bipyridyl)ruthenium(II)
Spectroscopy
Ligands

Cite this

Spillane, C. B., Morgan, J. L., Fletcher, N., Collins, J. G., & Keene, F. R. (2006). Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents. Dalton Transactions, 2006(25), 3122-3133. https://doi.org/10.1039/b516984d
Spillane, C.B. ; Morgan, J.L. ; Fletcher, Nicholas ; Collins, J.G. ; Keene, F.R. / Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents. In: Dalton Transactions. 2006 ; Vol. 2006, No. 25. pp. 3122-3133.
@article{5f40265b18f24836a62508678ae69879,
title = "Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents",
abstract = "The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.",
author = "C.B. Spillane and J.L. Morgan and Nicholas Fletcher and J.G. Collins and F.R. Keene",
year = "2006",
month = "2",
doi = "10.1039/b516984d",
language = "English",
volume = "2006",
pages = "3122--3133",
journal = "Dalton transactions (Cambridge, England : 2003)",
issn = "1477-9226",
publisher = "The Royal Society of Chemistry",
number = "25",

}

Spillane, CB, Morgan, JL, Fletcher, N, Collins, JG & Keene, FR 2006, 'Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents', Dalton Transactions, vol. 2006, no. 25, pp. 3122-3133. https://doi.org/10.1039/b516984d

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents. / Spillane, C.B.; Morgan, J.L.; Fletcher, Nicholas; Collins, J.G.; Keene, F.R.

In: Dalton Transactions, Vol. 2006, No. 25, 02.2006, p. 3122-3133.

Research output: Contribution to journalArticle

TY - JOUR

T1 - Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

AU - Spillane, C.B.

AU - Morgan, J.L.

AU - Fletcher, Nicholas

AU - Collins, J.G.

AU - Keene, F.R.

PY - 2006/2

Y1 - 2006/2

N2 - The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

AB - The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

UR - http://www.scopus.com/inward/record.url?scp=33745217807&partnerID=8YFLogxK

U2 - 10.1039/b516984d

DO - 10.1039/b516984d

M3 - Article

VL - 2006

SP - 3122

EP - 3133

JO - Dalton transactions (Cambridge, England : 2003)

JF - Dalton transactions (Cambridge, England : 2003)

SN - 1477-9226

IS - 25

ER -